gopubmed logo
 
find other proteinsAll proteins
GoPubMed Proteins lists recent and important papers and reviews for proteins. Page last changed on 08 Dec 2016.

SUMO1/sentrin specific peptidase 5

SENP5
The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP5, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009] (from NCBI)
Top mentioned proteins: Smt3, Ubiquitin, DAPI, CAN, SUMO-2
Papers using SENP5 antibodies
Nucleolar protein B23/nucleophosmin regulates the vertebrate SUMO pathway through SENP3 and SENP5 proteases
Supplier
Dasso Mary et al., In The Journal of Cell Biology, 2003
... siRNA oligonucleotides (SENP1, AATCCTTCCTCAGACAGTTTT; SENP2, AACATGCTGAAACTGGGTAAT; SENP3, AAACTCCGTACCAAGGGTTAT; SENP5, AAGTCCACTGGTCTCTCATTA; control, AACTGTCAGTCAGTCGTAGTA), Ni-NTA agarose, and Effectene were obtained from QIAGEN.
Papers on SENP5
Sentrin/small ubiquitin-like modifier-specific protease 5 protects oral cancer cells from oxidative stress-induced apoptosis.
New
Yu et al., Shanghai, China. In Mol Med Report, Aug 2015
The aim of the present study was to investigate the role of sentrin/small ubiquitin-like modifier (SUMO)-specific protease 5 (SENP5) in oral squamous cell carcinoma (OSCC), as the overexpression of SENP5 has been observed in 31 OSCC tissue specimens.
SENP5, a SUMO isopeptidase, induces apoptosis and cardiomyopathy.
Wang et al., Houston, United States. In J Mol Cell Cardiol, 2015
We observed a significant increase in the level of SENP5, a SUMO isopeptidase, in human idiopathic failing hearts.
Linking the SUMO protease SENP5 to neutrophil differentiation of AML cells.
Tschan et al., Bern, Switzerland. In Leuk Res Rep, 2014
In an mRNA profiling screen performed to unveil novel mechanisms of leukemogenesis, we found that the sentrin-specific protease 5 (SENP5) was significantly repressed in clinical acute myeloid leukemia when compared to healthy neutrophil samples.
Inhibition of SENP5 suppresses cell growth and promotes apoptosis in osteosarcoma cells.
Zhang et al., Shanghai, China. In Exp Ther Med, 2014
SENP5 is required for cell division, as well as maintaining mitochondrial morphology and function.
SENP5 mediates breast cancer invasion via a TGFβRI SUMOylation cascade.
Efroni et al., Ramat Gan, Israel. In Oncotarget, 2014
By iterating over the compendia of genes, we screened for their significance as prognosis biomarkers and identified SUMO-specific protease 5 (SENP5) to significantly stratify patients into two survival groups across five unrelated tested datasets.
Translocation of SenP5 from the nucleoli to the mitochondria modulates DRP1-dependent fission during mitosis.
McBride et al., Ottawa, Canada. In J Biol Chem, 2009
We recently identified a SUMO protease, SenP5, that deSUMOylates a number of mitochondrial targets, including the dynamin-related fission GTPase, DRP1.
Preparation of SUMO proteases and kinetic analysis using endogenous substrates.
Review
Lima et al., Barcelona, Spain. In Methods Mol Biol, 2008
The SUMO protease family includes two members in yeast (Ulp1 and Ulp2) and as many as six members in human (SENP1-3, SENP5-7).
FRET-based in vitro assays for the analysis of SUMO protease activities.
Review
Hay et al., Dundee, United Kingdom. In Methods Mol Biol, 2008
In humans cells three SUMO paralogues (SUMO-1, SUMO-2 and SUMO-3) and six SUMO specific proteases (SENP1-SENP3 and SENP5-SENP7) are expressed.
Nucleolar protein B23/nucleophosmin regulates the vertebrate SUMO pathway through SENP3 and SENP5 proteases.
GeneRIF
Dasso et al., Bethesda, United States. In J Cell Biol, 2008
Nucleolar protein B23/nucleophosmin regulates the vertebrate SUMO pathway through SENP3 and SENP5 proteases.
Structure of the human SENP7 catalytic domain and poly-SUMO deconjugation activities for SENP6 and SENP7.
Reverter et al., New York City, United States. In J Biol Chem, 2008
Six SUMO proteases constitute the human SENP/ULP protease family (SENP1-3 and SENP5-7).
Overexpression of SENP5 in oral squamous cell carcinoma and its association with differentiation.
GeneRIF
Chen et al., Shanghai, China. In Oncol Rep, 2008
altered subcellular localization of SENP5 in oral squamous cell carcinoma (OSCC) cells and the correlation between SENP5 expression and the differentiation of OSCC.
The SUMO protease SENP5 is required to maintain mitochondrial morphology and function.
McBride et al., Ottawa, Canada. In J Cell Sci, 2007
We demonstrate that the cytosolic pool of SENP5 catalyzes the cleavage of SUMO1 from a number of mitochondrial substrates.
SUMO-specific proteases and the cell cycle. An essential role for SENP5 in cell proliferation.
Review
Gill et al., Boston, United States. In Cell Cycle, 2006
We have recently described the activities of a new SUMO-specific protease, SENP5.
Characterization of a family of nucleolar SUMO-specific proteases with preference for SUMO-2 or SUMO-3.
Yeh et al., Houston, United States. In J Biol Chem, 2006
Here, we have described SENP5, which has restricted substrate specificity.
The SUMO-specific protease SENP5 is required for cell division.
GeneRIF
Gill et al., Boston, United States. In Mol Cell Biol, 2006
Knockdown of SENP5 resulted in increased levels of SUMO-1 and SUMO-2/3, inhibition of cell proliferation, defects in nuclear morphology, and appearance of binucleate cells, revealing an essential role for SENP5 in mitosis and/or cytokinesis.
share on facebooktweetadd +1mail to friends