gopubmed logo
 
find other proteinsAll proteins
GoPubMed Proteins lists recent and important papers and reviews for proteins. Page last changed on 19 Aug 2016.

Profilin 2

PFL, profilin II, PFN2
The protein encoded by this gene is a ubiquitous actin monomer-binding protein belonging to the profilin family. It is thought to regulate actin polymerization in response to extracellular signals. There are two alternatively spliced transcript variants encoding different isoforms described for this gene. [provided by RefSeq, Jul 2008] (from NCBI)
Top mentioned proteins: CAN, profilin, ACID, Actin, V1a
Papers on PFL
Manipulating pyruvate to acetyl-CoA conversion in Escherichia coli for anaerobic succinate biosynthesis from glucose with the yield close to the stoichiometric maximum.
New
Debabov et al., Moscow, Russia. In J Biotechnol, Dec 2015
Pyruvate dehydrogenase (PDH) or pyruvate formate lyase (PFL) serves in E. coli as a source of acetyl-CoA, a substrate for the glyoxylate bypass.
Quantitative structure-activity relationship correlation between molecular structure and the Rayleigh enantiomeric enrichment factor.
New
Lev et al., Jerusalem, Israel. In Environ Sci Process Impacts, Aug 2015
Enantioselective hydrolysis of sixteen derivatives of 2-(phenoxy)propionate (PPMs) have been analyzed during enzymatic degradation by lipases from Pseudomonas fluorescens (PFL), Pseudomonas cepacia (PCL), and Candida rugosa (CRL).
Studying protein fold evolution with hybrids of differently folded homologs.
New
Cordes et al., Tucson, United States. In Protein Eng Des Sel, Aug 2015
To study the sequence determinants governing protein fold evolution, we generated hybrid sequences from two homologous proteins with 40% identity but different folds: Pfl 6 Cro, which has a mixed α + β structure, and Xfaso 1 Cro, which has an all α-helical structure.
Ethanol production by engineered thermophiles.
Review
New
Lynd et al., United States. In Curr Opin Biotechnol, Jun 2015
Ethanol production from pyruvate can proceed via one of four pathways, which are named by the key pyruvate dissimilating enzyme: pyruvate decarboxylase (PDC), pyruvate dehydrogenase (PDH), pyruvate formate lyase (PFL), and pyruvate ferredoxin oxidoreductase (PFOR).
Structure and Function of a Novel Class of High Mannose-binding Proteins with Anti-viral or Anti-tumor Activity.
Review
Sato, In Yakugaku Zasshi, 2014
In addition, some of these lectins, such as bacterial PFL, show cytotoxicity for various cancer cells at low micromolar levels.
Physiological roles of pyruvate ferredoxin oxidoreductase and pyruvate formate-lyase in Thermoanaerobacterium saccharolyticum JW/SL-YS485.
Lynd et al., United States. In Biotechnol Biofuels, 2014
In T. saccharolyticum, the products of six putative pfor gene clusters and one pfl gene may be responsible for the conversion of pyruvate to acetyl-CoA.
Glycyl radical activating enzymes: structure, mechanism, and substrate interactions.
Review
Broderick et al., Bozeman, United States. In Arch Biochem Biophys, 2014
The GRE-AE pyruvate formate lyase activating enzyme (PFL-AE) is extensively characterized and has provided insights into the active site structure of radical SAM enzymes including GRE-AEs, illustrating the nature of the interactions with their corresponding substrate GREs and external electron donors.
Decreased expression of profilin 2 in oral squamous cell carcinoma and its clinicopathological implications.
GeneRIF
Han et al., Shanghai, China. In Oncol Rep, 2011
Oral squamous cell carcinomas with weak PFN2 expression were associated with a significantly worse prognosis than strongly expressed tumours.
Phosphorylation of profilin by ROCK1 regulates polyglutamine aggregation.
GeneRIF
Diamond et al., San Francisco, United States. In Mol Cell Biol, 2008
A signaling pathway from ROCK1 to profilin controls polyglutamine protein aggregation.
Identification of Rgl3 as a potential binding partner for Rap-family small G-proteins and profilin II.
GeneRIF
Kitayama et al., Kyoto, Japan. In Cell Signal, 2007
These findings raise the possibility that Rgl3 mediates interaction between Ras/Rap-family proteins and profilin II, an important activator of actin polymerization.
The Diaphanous-related formin dDia2 is required for the formation and maintenance of filopodia.
Impact
Faix et al., München, Germany. In Nat Cell Biol, 2005
Dictyostelium discoideum Diaphanous-related formin dDia2 is enriched at the tips of filopodia and interacts with profilin II and Rac1.
Prediction of TP53 status for primary cisplatin, fluorouracil, and leucovorin chemotherapy in ethmoid sinus intestinal-type adenocarcinoma.
Impact
Pilotti et al., Milano, Italy. In J Clin Oncol, 2005
PATIENTS AND METHODS: Thirty patients with ethmoidal ITAC enrolled onto a phase II study received chemotherapy with cisplatin, fluorouracil, and leucovorin (PFL) followed by surgery and radiation.
Fermentative Pyruvate and Acetyl-Coenzyme A Metabolism.
Clark et al., In Ecosal Plus, 2004
Consequently, in the absence of an electron acceptor mutants lacking either branch of acetyl-CoA metabolism fail to cleave pyruvate, despite the presence of PFL, and instead reduce it to D-lactate by the D-lactate dehydrogenase.
[Vascular-specific promoters and cis-regulatory elements].
Review
Jia et al., Beijing, China. In Sheng Wu Gong Cheng Xue Bao, 2003
The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins).
A glycyl radical solution: oxygen-dependent interconversion of pyruvate formate-lyase.
Review
Watson et al., Norwich, United Kingdom. In Mol Microbiol, 1998
Pyruvate formate-lyase (PFL) catalyses the non-oxidative dissimilation of pyruvate to formate and acetyl-CoA using a radical-chemical mechanism.
Dictyostelium amoebae that lack G-actin-sequestering profilins show defects in F-actin content, cytokinesis, and development.
Impact
Schleicher et al., Martinsried, Germany. In Cell, 1994
The aberrant phenotype could be rescued by reintroducing a functional profilin I or profilin II gene.
Induction chemotherapy with cisplatin, fluorouracil, and high-dose leucovorin for locally advanced head and neck cancer: a clinical and pharmacologic analysis.
Impact
Panje et al., Chicago, United States. In J Clin Oncol, 1990
Therefore, the addition of LV to cisplatin and 5-FU (PFL) may increase the activity of that combination in head and neck cancer.
Structure of coat proteins in Pf1 and fd virions by laser raman spectroscopy.
Impact
Murphy et al., In Science, 1975
The amino acid compositions of coat proteins in Pfl and fd strains are recognized by their different side-chain vibrational frequencies.
share on facebooktweetadd +1mail to friends