gopubmed logo
find other proteinsAll proteins
GoPubMed Proteins lists recent and important papers and reviews for proteins. Page last changed on 19 Aug 2016.

CCR4-NOT transcription complex, subunit 1

NotI, NOT1
Top mentioned proteins: CAN, pFGE, HAD, ACID, POLYMERASE
Papers using NotI antibodies
Mitotic chromosome structure: reproducibility of folding and symmetry between sister chromatids.
Misteli Tom, In PLoS Biology, 2008
... A blunted NcoI/NotI fragment containing eGFP from the pEGFP-N1 vector (Clontech) was subcloned in-frame into ...
Faithful expression of GFP from the PLC β2 promoter in a functional class of taste receptor cells.
Blagosklonny Mikhail V., In PLoS ONE, 2005
... The C-YFP cDNA was released with NotI and XbaI (1818 bp) and cloned into pBI vector (BD Biosciences).
Phenotypic correction and long-term expression of factor VIII in hemophilic mice by immunotolerization and nonviral gene transfer using the Sleeping Beauty transposon system
Hayashizaki Yoshihide, In PLoS Genetics, 2004
... NotI fragment was excised and cloned into the NotI site of pCMV-bgal vector (Clontech, Palo Alto, California, United ...
Suppression of two major Fragile X Syndrome mouse model phenotypes by the mGluR5 antagonist MPEP.
Cox Gregory A., In PLoS Genetics, 2004
... The plasmid was linearized with NotI and used to electroporate ES cells at the Transgenic Services Laboratory at The ...
Ataxin-2 and huntingtin interact with endophilin-A complexes to function in plastin-associated pathways.
Fernandez-Funez Pedro, In PLoS ONE, 2004
... was generated by subcloning a DNA fragment generated via PCR using the oligonucleotide pair FOX-2-s-SalI and FOX-2-as-NotI and human fetal brain library (Clontech; Mountain View, USA) as ...
more suppliers
Papers on NotI
Gene expression regulatory networks in Trypanosoma brucei: Insights into the role of the mRNA-binding proteome.
Erben et al., Heidelberg, Germany. In Mol Microbiol, Feb 2016
A yeast two-hybrid screen showed that several of the discovered repressors interact with components of the CAF1/NOT1 deadenylation complex.
Serogroup, virulence, and molecular traits of Vibrio parahaemolyticus isolated from clinical and cockle sources in northeastern Thailand.
Chomvarin et al., Khon Kaen, Thailand. In Infect Genet Evol, Feb 2016
Pulsed-field gel electrophoresis of NotI-digested genomic DNA of 41 randomly selected V. parahaemolyticus isolates representing different serotypes produced 33 pulsotypes that formed 5 different clusters (clonal complexes) (A-E) in a dendrogram.
Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1.
Sater et al., Houston, United States. In Dev Biol, Feb 2016
Overexpression of miR-26 resulted in moderately decreased expression of Smad1-dependent genes and an expansion of the region expressing the Organizer gene not1.
Light and CO2/cAMP signal crosstalk on the promoter elements of chloroplastic β-carbonic anhydrase genes in the marine diatom Phaeodactylum tricornutum.
Matsuda et al., Sanda, Japan. In Plant Physiol, Jan 2016
This suppression effect disappeared when CCRE2 or two of three CCREs were replaced with a NotI restriction site, strongly suggesting that light signal cross-talks with CO2 on the cAMP-signal transduction pathway which targets CCREs.
Integrin α9 gene promoter is hypermethylated and downregulated in nasopharyngeal carcinoma.
Ernberg et al., Stockholm, Sweden. In Oncotarget, Nov 2015
Among ten candidate TSGs identified in chromosome 3 using NotI microarray, ITGA9 and WNT7A could be validated.
[Methylation in the Regulation of the Expression of Chromosome 3 and microRNA Genes in Clear-Cell Renal Cell Carcinomas].
Kushlinskii et al., In Genetika, Jun 2015
The results are based on the use of genomic NotI-microarrays (which allow the identification of both methylation and deletions in genes containing CpG islands) and on some other approaches.
Identification of Novel Epigenetic Markers of Prostate Cancer by NotI-Microarray Analysis.
Kashuba et al., Moscow, Russia. In Dis Markers, 2014
NotI-microarrays with 180 clones associated with chromosome 3 genes/loci were applied to determine genetic and epigenetic alterations in 33 prostate tumors.
Cloning and prokaryotic expression of the porcine lipasin gene.
Yang et al., Zhengzhou, China. In Genet Mol Res, 2014
The polymerase chain reaction product was cloned to a pGEM®-T Easy Vector, digested by SalI and NotI, and sequenced.
Phylogenetic distribution and evolution of the linked RNA-binding and NOT1-binding domains in the tristetraprolin family of tandem CCCH zinc finger proteins.
Perera et al., United States. In J Interferon Cytokine Res, 2014
In general, the encoded proteins contain 2 critical macromolecular interaction domains: the CCCH TZF domain, which is necessary for high-affinity binding to AU-rich elements in mRNA; and an extreme C-terminal domain that, in the case of TTP, interacts with NOT1, the scaffold of a large multi-protein complex that contains deadenylases.
The CAF1-NOT complex of trypanosomes.
Clayton et al., Heidelberg, Germany. In Front Genet, 2013
The trypanosome CAF1-NOT complex is simpler than that of other organisms, with no CCR4 or NOT4 homolog: it consists of CAF1, NOT1, NOT2, NOT5 NOT9, NOT10, and NOT11.
Cnot1, Cnot2, and Cnot3 maintain mouse and human ESC identity and inhibit extraembryonic differentiation.
Hu et al., United States. In Stem Cells, 2012
Cnot1, Cnot2, and Cnot3 represent a novel component of the core self-renewal and pluripotency circuitry conserved in mouse and human ESCs.
The role of the CNOT1 subunit of the CCR4-NOT complex in mRNA deadenylation and cell viability.
Yamamoto et al., Tokyo, Japan. In Protein Cell, 2011
Depletion of CNOT1 induces cell death in a caspase-dependent manner.
Insights into the structure of the CCR4-NOT complex by electron microscopy.
Böttcher et al., Heidelberg, Germany. In Febs Lett, 2011
Results describe the structure of the purified CCR4-NOT complex as determined by electron microscopy.
Human Ccr4-Not complexes contain variable deadenylase subunits.
Timmers et al., Utrecht, Netherlands. In Biochem J, 2009
Data show that Ccr4-Not function in RNA splicing and nuclear export, and that CNOT1 binds CNOT4 in yeast two-hybrid assays.
Epigenetics: differential DNA methylation in mammalian somatic tissues.
Ghosh et al., Tokyo, Japan. In Febs J, 2008
We then present a rough overview of quantitative DNA methylation patterns at 4600 NotI sites and more than 150 differentially methylated regions in several C57BL/6J mouse tissues.
Human Ccr4-Not complex is a ligand-dependent repressor of nuclear receptor-mediated transcription.
Timmers et al., Utrecht, Netherlands. In Embo J, 2006
CNOT1 interacts in a ligand-dependent manner with RXR and represses transcription mediated by several RXR heterodimers.
Epigenome analyses using BAC microarrays identify evolutionary conservation of tissue-specific methylation of SHANK3.
Costello et al., San Francisco, United States. In Nat Genet, 2005
We developed a method for high-resolution analysis of the methylation status of CpG islands genome-wide, using arrays of BAC clones and the methylation-sensitive restriction enzyme NotI.
[From identification of genomic polymorphism to diagnostic and prognostic markers of human epithelial tumors].
Zabarovskiĭ et al., Moscow, Russia. In Mol Biol (mosk), 2004
To find new polymorphic loci in the human genome, di-, tri-, and tetranucleotide repeats were searched for in an ordered cosmid library of chromosome 13, NotI and cosmid clones of chromosome 3, and in brain EST.
Identification of an imprinted U2af binding protein related sequence on mouse chromosome 11 using the RLGS method.
Muramatsu et al., Tsukuba, Japan. In Nat Genet, 1994
Eight out of 3,100 strain-specific NotI and BssHII spots were identified as imprinted in reciprocal F1 hybrids.
Cloning of the essential myotonic dystrophy region and mapping of the putative defect.
Vooijs et al., Livermore, United States. In Nature, 1992
This segment has been extensively characterized through the isolation of five YAC clones and the subsequent subcloning in cosmids from which a detailed EcoRI, HindIII, MluI and NotI restriction map has been derived.
More papers using NotI antibodies
HOXA3 induces cell migration in endothelial and epithelial cells promoting angiogenesis and wound repair
Awgulewitsch Alexander et al., In BMC Developmental Biology, 2004
... Not1 restriction enzymes for the preparation of transgenic mice ...
Compilation of published comparative genomic hybridization studies
Liu Limin et al., In Carcinogenesis, 2001
... -targeting vector was linearized by NotI and introduced into embryonic stem (ES) cells from 129sv mice for homologous recombination (UCSF transgenic mouse facility) ...
The mobile nucleoporin Nup2p and chromatin-bound Prp20p function in endogenous NPC-mediated transcriptional control
Aitchison John D. et al., In The Journal of Cell Biology, 1999
... The pGST-CFP plasmid was created by ligating the SalI-NotI fragment containing the ECFP gene from pECFP (BD Biosciences) into pGEX-4T1 (GE Healthcare) ...
Role of dynein, dynactin, and CLIP-170 interactions in LIS1 kinetochore function
Vallee Richard B. et al., In The Journal of Cell Biology, 1999
... They were then cloned into the NotI site of pCMVβ (CLONTECH Laboratories, Inc.) ...
Marching at the front and dragging behind
Wehrle-Haller Bernhard et al., In The Journal of Cell Biology, 1999
... pcDNA3/EGFP was prepared by insertion of the HindIII/NotI EGFP containing fragment from pEGFP-N1 (CLONTECH Laboratories, Inc.) into pcDNA3 ...
Krox-20 controls SCIP expression, cell cycle exit and susceptibility to apoptosis in developing myelinating Schwann cells
Messing Albee et al., In The Journal of Cell Biology, 1998
... For oocyte injection, the transgene monomer was excised from the vector using XhoI and NotI.Transgenic mice were obtained by ...
Inactivation of the p53-homologue p73 by the mdm2-oncoprotein.
Tyagi Anil Kumar, In PLoS ONE, 1998
... The DNA fragment was cloned into the BglII and NotI sites of pLPCX retroviral vector (Clontech) in-frame to the N-terminus ...
Comparative fitness of multi-dideoxynucleoside-resistant human immunodeficiency virus type 1 (HIV-1) in an In vitro competitive HIV-1 replication assay
Wood Charles et al., In Retrovirology, 1998
... 1084i provirus was excised from the parental pCR2.1 Topo cloning vector (Invitrogen, Carlsbad, CA) by NotI (all restriction enzymes were from New England Biolabs) and subcloned into the ...
Impaired mammary gland and lymphoid development caused by inducible expression of Axin in transgenic mice
Costantini Frank et al., In The Journal of Cell Biology, 1998
... Plasmid pTRE2–Axin–GFP was constructed by first inserting the 1.4-kb SacII-NotI fragment of IRES and enhanced GFP (pIRES2-GFP; CLONTECH Laboratories, Inc.) in the ...
Chromosomal landscape of nucleosome-dependent gene expression and silencing in yeast
Cook Peter R. et al., In The Journal of Cell Biology, 1998
... Next, the BamHI-NotI fragment was replaced with the BglII-NotI fragment of pEGFP-N1 (CLONTECH Laboratories, Inc.) to generate ...
Intermediate filament–membrane attachments function synergistically with actin-dependent contacts to regulate intercellular adhesive strength
Green Kathleen J. et al., In The Journal of Cell Biology, 1997
... The resulting fragment was subcloned into the NotI/NheI sites of the pTRE2 response plasmid (CLONTECH Laboratories, Inc.), producing vector ...
Mammalian circadian autoregulatory loop: A timeless ortholog and mPer1 interact and negatively regulate CLOCK-BMAL1-induced transcription
Barsh Gregory S, In PLoS Genetics, 1997
... Amplified product was digested with NotI and HindIII, gel purified, and ligated into the NotI-HindIII cloning site of the pTRE2 plasmid (Clontech, ...
An alternative pathway for STAT activation that is mediated by the direct interaction between JAK and STAT
Nakayama Toshinori et al., In The Journal of Experimental Medicine, 1996
... A NotI fragment of this plasmid was isolated and injected into fertilized eggs of B6, and three lines of transgenic (Tg) mice were established ...
Importin β contains a COOH-terminal nucleoporin binding region important for nuclear transport
Gerace Larry et al., In The Journal of Cell Biology, 1994
... ) and insertion of the PCR products into the NdeI and NotI sites of the pTYB2 vector (New England Biolabs, Inc.) ...
Complete nucleotide sequence, genome organization, and biological properties of human immunodeficiency virus type 1 in vivo: evidence for limited defectiveness and complementation
Zolla-Pazner Susan, In PLoS Medicine, 1991
... Colonies were screened for presence of HIV-1 Env by restriction digestion with MluI and NotI (New England Biolabs), and the entire HIV-1 ...
Functional expression of plant plasma membrane H(+)-ATPase in yeast endoplasmic reticulum
Kaiser Chris A. et al., In The Journal of Cell Biology, 1991
... polylinker of pKR17 was deleted with a 350-bp SmaI/NaeI fragment (pKR17Δ), and then a 12-bp linker carrying a NotI site (1127; New England BioLabs) was inserted at the ...
Whole mount in situ hybridization of vertebrate embryos.
Bronner-Fraser Marianne, In PLoS Genetics, 1991
... For ES cell targeting, the targeting vector was linearized with Not1 and electroporated into D1 ES cells derived from F1 hybrid blastocysts of 129S6 x C57BL/6J by Gene Targeting & Transgenic Facility at University of ...
Nebulin-deficient mice exhibit shorter thin filament lengths and reduced contractile function in skeletal muscle
Chen Ju et al., In The Journal of Cell Biology, 1987
... The targeting construct was verified by sequencing and linearized with NotI before electroporation into R1 ES cells at the Transgenic Core Facility at the ...
A community effect in animal development
Choi Yongwon et al., In The Journal of Experimental Medicine, 1987
NotI-KpnI PGKNeopA fragment, were microinjected into C57BL/6 blastocysts to produce germline chimeras.For TRANCE.TG mice, we have generated several transgenic mouse lines overexpressing TRANCE ...
A selective defect in arachidonic acid release from macrophage membranes in high potassium media
Aderem Alan et al., In The Journal of Experimental Medicine, 1983
... 3′ reverse primer, GGGAGCTCCCATATTATCATCGTGTT; Novagen) and the coding region for enhanced GFP (eGFP) from peGFP-N1 (EcoRI-NotI fragment; Clontech).
share on facebooktweetadd +1mail to friends