gopubmed logo
find other proteinsAll proteins
GoPubMed Proteins lists recent and important papers and reviews for proteins. Page last changed on 19 Aug 2016.

MLX interacting protein

MONDOA forms heterodimers with MLX (MIM 602976) that can bind to and activate transcription from CACGTG E boxes (Billin et al., 2000 [PubMed 11073985]).[supplied by OMIM, Mar 2008] (from NCBI)
Top mentioned proteins: V1a, CAN, POLYMERASE, HAD, Akt
Papers using miR antibodies
The cluster of miR-143 and miR-145 affects the risk for esophageal squamous cell carcinoma through co-regulating fascin homolog 1
Toland Amanda Ewart, In PLoS ONE, 2011
... miR-499 rs3746444 polymorphism and cancer risk, a systematic search of the US National Library of Medicine's Pubmed database, Excerpta Medica Database (Embase) and Chinese Biomedical Literature Database (CBM) was ...
microRNA-34c is a novel target to treat dementias.
Rishi Arun, In PLoS ONE, 2010
... Anti-hsa-miR-122 miScript miRNA inhibitor (MIN0000421), syn-hsa-miR-122 miScript miRNA mimic (MSY0000421) and the AllStars Negative Control siRNA were purchased from Qiagen (Valencia, CA) ...
MicroRNA-519c suppresses hypoxia-inducible factor-1alpha expression and tumor angiogenesis
Abdelmohsen Kotb et al., In Aging (Albany NY), 2009
... miR-519a (Ambion) or control siRNA (AATTCTCCGAACGTGTCACGT, Qiagen) were transfected at a ...
CLOCK and NPAS2 have overlapping roles in the circadian oscillation of arylalkylamine N-acetyltransferase mRNA in chicken cone photoreceptors
Lewin Alfred, In PLoS ONE, 2009
... Synthesized RNA duplexes of miR-30b mimics and miR-30b antagomirs were purchased from Qiagen (Valencia, CA) ...
Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists
Martelli Fabio, In PLoS ONE, 2008
... hsa-miR-29a was expressed from pEGFP-N3 (Clontech).
more suppliers
Papers on miR
miRNA-Regulated Key Components of Cytokine Signaling Pathways and Inflammation in Rheumatoid Arthritis.
Chakraborty et al., Ch'unch'ŏn, South Korea. In Med Res Rev, Feb 2016
From the analyzed data, we suggest that miR-146a and miR-155 might be the potential therapeutic target for treating RA.
MiR-215 Is Induced Post-transcriptionally via HIF-Drosha Complex and Mediates Glioma-Initiating Cell Adaptation to Hypoxia by Targeting KDM1B.
Wang et al., Durham, United States. In Cancer Cell, Feb 2016
Here, we report that hypoxia-induced miR-215 is vital for reprograming GICs to fit the hypoxic microenvironment via suppressing the expression of an epigenetic regulator KDM1B and modulating activities of multiple pathways.
Pathobiology of MicroRNAs and Their Emerging Role in Thyroid Fine-Needle Aspiration.
Kholová et al., Praha, Czech Republic. In Acta Cytol, Feb 2016
Expression of miRs is tissue-specific and each alteration of the tissue miR profile is associated with a distinct disease status.
Identification, Review, and Systematic Cross-Validation of microRNA Prognostic Signatures in Metastatic Melanoma.
Yang et al., Sydney, Australia. In J Invest Dermatol, Jan 2016
Five miRNAs (miR-142-5p, miR-150-5p, miR-342-3p, miR-155-5p, and miR-146b-5p) were reproducibly associated with patient outcome and have the greatest potential for application in the clinic.
Strand-specific in vivo screen of cancer-associated miRNAs unveils a role for miR-21(∗) in SCC progression.
Fuchs et al., New York City, United States. In Nat Cell Biol, Jan 2016
Focusing on miRs and/or miR(∗)s abundant in squamous cell carcinoma (SCC) stem cells, we engineer an efficient, strand-specific expression library, and apply functional genomics screening in mice to identify which of 169 cancer-associated miRs are key drivers in malignant progression.
Loss of motoneuron-specific microRNA-218 causes systemic neuromuscular failure.
Pfaff et al., Los Angeles, United States. In Science, Jan 2016
One miRNA, miR-218, is abundantly and selectively expressed by developing and mature motoneurons.
Self-assembled RNA-triple-helix hydrogel scaffold for microRNA modulation in the tumour microenvironment.
Artzi et al., Cambridge, United States. In Nat Mater, Jan 2016
UNASSIGNED: The therapeutic potential of miRNA (miR) in cancer is limited by the lack of efficient delivery vehicles.
MicroRNA-126 enhances the sensitivity of osteosarcoma cells to cisplatin and methotrexate.
Tao et al., Changsha, China. In Oncol Lett, Dec 2015
The present study aimed to observe the effect of DDP, MTX and rapamycin on osteosarcoma cell proliferation and apoptosis, and to investigate the association between miR-126 and the effects of DDP and MTX in osteosarcoma cells.
The significance of microRNA-184 on JAK2/STAT3 signaling pathway in the formation mechanism of glioblastoma.
Zhai et al., Linyi, China. In Oncol Lett, Dec 2015
The aim of the present study was to examine the expression of microRNA (miR)-184 in Janus kinase 2/signal transducer and activator of transcription 3 (JAK2/STAT3) signaling pathway in the mechanism of glioblastoma formation, thus providing a new basis for the mechanism of glioblastoma induction.
Circulating MicroRNAs as Biomarkers for Sepsis.
Luedde et al., Aachen, Germany. In Int J Mol Sci, Dec 2015
By using array- and single PCR-based methods, a variety of deregulated miRNAs, including miR-25, miR-133a, miR-146, miR-150, and miR-223, were described in the context of sepsis.
Epigenetic changes and nuclear factor-κB activation, but not microRNA-224, downregulate Raf-1 kinase inhibitor protein in triple-negative breast cancer SUM 159 cells.
Notarbartolo et al., Palermo, Italy. In Oncol Lett, Dec 2015
Bisulphite modification, methylation specific-polymerase chain reaction (PCR) and a TransAM NF-κB assay were performed and the results suggested that various mechanisms, including methylation of the gene promoter, histone deacetylation and nuclear factor-κB (NF-κB) activation, but not targeting by microRNA-224 (miR/miRNA-224), as determined by transfection of pre-miR-224 miRNA precursor or anti-miR-224 miRNA inhibitor, may downregulate RKIP in these cells.
MicroRNA-214 suppresses the proliferation of human hepatocellular carcinoma cells by targeting E2F3.
Huang et al., Xi'an, China. In Oncol Lett, Dec 2015
Previous studies have implicated that miR-214 is a tumor suppressor that is capable of inhibiting human hepatocellular carcinoma (HCC) cell growth.
Epithelial-to-mesenchymal transition is not required for lung metastasis but contributes to chemoresistance.
Gao et al., New York City, United States. In Nature, Dec 2015
Inhibiting EMT by overexpressing the microRNA miR-200 does not affect lung metastasis development.
[Non-coding RNAs in castration-resistant prostate cancer].
Jiang et al., In Zhonghua Nan Ke Xue, Nov 2015
Some of the ncRNAs act as cancer genes, such as miR-19a, miR-125b, miR-616, miR-7, miR-221, MALAT-1, and PRNCR1, which are upregulated in castration-resistant prostate cancer (CRPC) tissues or cell lines, and promote the development and progression of CRPC, some act as tumor suppressor genes, including miR-185, miR-342, miR-15, miR-16, and miR-146, which are downregulated in CRPC tissues or cell lines and inhibit or delay the occurrence of CRPC, and still others, such as miR-7, miR-19a, miR-125b, miR-221, and MALAT-1, are differentially expressed in the serum or tissue and can be used as potential biomarkers for the early diagnosis and prognosis of CRPC.
Downregulation of miR-221 Inhibits Cell Migration and Invasion through Targeting Methyl-CpG Binding Domain Protein 2 in Human Oral Squamous Cell Carcinoma Cells.
Chen et al., Guangzhou, China. In Biomed Res Int, 2014
In the present study, we detected the expression of miR-221 in two highly metastatic OSCC cell lines and two OSCC cell lines that are less metastatic using quantitative real-time PCR analysis (qRT-PCR).
MondoA is highly overexpressed in acute lymphoblastic leukemia cells and modulates their metabolism, differentiation and survival.
Grunewald et al., München, Germany. In Leuk Res, 2012
An important contribution of MondoA to leukemia aggressiveness, which makes MondoA a potential candidate for targeted treatment of acute lymphoblastic leukemia.
Fibroblast growth factor-21 (FGF21) regulates low-density lipoprotein receptor (LDLR) levels in cells via the E3-ubiquitin ligase Mylip/Idol and the Canopy2 (Cnpy2)/Mylip-interacting saposin-like protein (Msap).
Lindholm et al., Helsinki, Finland. In J Biol Chem, 2012
FGF21 also enhanced expression of Canopy2 (Cnpy2)/MIR-interacting Saposin-like protein (Msap) that is known to interact with Mylip/Idol.
Transcriptome characterization of estrogen-treated human myocardium identifies myosin regulatory light chain interacting protein as a sex-specific element influencing contractile function.
Regitz-Zagrosek et al., Berlin, Germany. In J Am Coll Cardiol, 2012
Estradiol-treatment led to impaired contractile function in male cardiomyocytes only, which was characterized by increased Mylip mRNA and protein levels, and decreased myosin regulatory light chain protein.
FERM-dependent E3 ligase recognition is a conserved mechanism for targeted degradation of lipoprotein receptors.
Tontonoz et al., Los Angeles, United States. In Proc Natl Acad Sci U S A, 2012
These data identify the IDOL-LDLR interaction as an evolutionarily conserved mechanism for the regulation of lipid uptake and suggest that this interaction could potentially be exploited for the pharmacologic modulation of lipid metabolism.
MondoA senses non-glucose sugars: regulation of thioredoxin-interacting protein (TXNIP) and the hexose transport curb.
Ayer et al., Salt Lake City, United States. In J Biol Chem, 2011
the MondoA-TXNIP regulatory circuit has a role in the hexose transport curb, although other redundant pathways also contribute
More papers using miR antibodies
The transcription factor ETS-1: its role in tumour development and strategies for its inhibition.
Lee Terence, In PLoS ONE, 2007
... gene silencing experiments, vector based RNA interference (RNAi) was applied using the BLOCK-iT™ Pol II miR RNAi system (Invitrogen by Life Technologies, Carlsbad, CA, USA) ...
Identification of novel modulators of mitochondrial function by a genome-wide RNAi screen in Drosophila melanogaster.
Orr Harry T., In PLoS Genetics, 2007
... The UAS-miR-277-Sponge transgenic flies were generated as ...
The resource: targets and expression
Ordovas Jose M et al., In BMC Genomics, 2007
... accession, PS = miRanda Pairing Score, ES = miRanda energy score, S-T = seed type, miRlit = evidence of miR and mRNA expression collected from the literature, where numbers indicate pubmed ids, except those beginning with ...
Electrospray ionization mass spectrometry of oligonucleotides.
Antopolsky Maxim, In PLoS ONE, 2007
... A target oligonucleotide and two antisense probes targeting human microRNA miR-375 were custom synthesized and HPLC-purified by Invitrogen Life technologies.
Insulin-like growth factor-I inhibits transcriptional responses of transforming growth factor-beta by phosphatidylinositol 3-kinase/Akt-dependent suppression of the activation of Smad3 but not Smad2.
Nurminsky Dmitry I., In PLoS ONE, 2002
... Antibodies, LNA-based Pre-miR(s), anti-miR(s) inhibitors, siRNA(s)The antibodies used for Western Blot analysis are Glut4 (Abcam, ab654), Glut3 (made in ...
share on facebooktweetadd +1mail to friends