gopubmed logo
find other proteinsAll proteins
GoPubMed Proteins lists recent and important papers and reviews for proteins. Page last changed on 19 Aug 2016.

Serpin peptidase inhibitor, clade D

heparin cofactor II, HCII, HC2
The product encoded by this gene is a serine proteinase inhibitor which rapidly inhibits thrombin in the presence of dermatan sulfate or heparin. The gene contains five exons and four introns. This protein shares homology with antithrombin III and other members of the alpha 1-antitrypsin superfamily. Mutations in this gene are associated with heparin cofactor II deficiency. [provided by RefSeq, Jul 2008] (from NCBI)
Top mentioned proteins: HAD, AGE, CAN, ACID, PAP
Papers using heparin cofactor II antibodies
Interim guidance for the use of human papillomavirus DNA testing as an adjunct to cervical cytology for screening
Wilander E et al., In British Journal of Cancer, 2003
... At the laboratory, the samples were used for high-risk HPV testing with the Hybrid Capture 2 (hc2) method (Qiagen AB, Solna, Sweden) ...
Covalent transfer of heavy chains of inter-α-trypsin inhibitor family proteins to hyaluronan in in vivo and in vitro expanded porcine oocyte-cumulus complexes
Tseng Scheffer C. G. et al., In The Journal of Biological Chemistry, 2003
... siRNA oligonucleotide for targeting endogenous human TSG-6 (GGUUUCCAAAUCAAAUAUGUUGCAA), HC2 (GGAUCAAAUAGAGAGCGUUAUCACG), and bikunin (GGUAUUUCUAUAAUGGUACAUCCAT) were from OriGene Technologies (Rockville, MD) ...
Interim guidance for the use of human papillomavirus DNA testing as an adjunct to cervical cytology for screening
Meijer C J L M et al., In British Journal of Cancer, 2003
... study designed to evaluate the effectiveness of combined cervical cytology screening with hrHPV testing by HC2 hybridisation assay (Qiagen, Gaithersburg, MD, USA) ...
Validity of self-obtained vaginal specimens for diagnosis of trichomoniasis
Abravaya K. et al., In Journal of Oncology, 1996
... The L-Pap sample was tested for HR HPV with the HC2 test (Qiagen, Gaithersburg, Md, USA) at ...
Papers on heparin cofactor II
High-risk HPV testing in the management of atypical glandular cells: A systematic review and meta-analysis.
Arbyn et al., Brussels, Belgium. In Int J Cancer, Feb 2016
The pooled sensitivity and specificity of hrHPV-testing with Hybrid Capture 2 (HC2) to detect CIN2+/AIS+ in women with AGC was 90.0% (95% CI = 85.1-93.4%)
Comparison of Analytical and Clinical Performance of HPV 9G DNA Chip, PANArray HPV Genotyping Chip, and Hybrid-Capture II Assay in Cervicovaginal Swabs.
Kim et al., Seoul, South Korea. In J Pathol Transl Med, Feb 2016
Purpose: Human papillomavirus (HPV) infection can be detected by using several molecular methods, including Hybrid-Capture II (HC2) assay and variable HPV DNA chip tests, although each method has different sensitivities and specificities.
HPV detection-based cervical cancer screening program in low-resource setting: lessons learnt from a community-based demonstration project in India.
Basu et al., Calcutta, India. In Cancer Causes Control, Jan 2016
Compliance to recall of HC2-positive women for colposcopy was 78 %.
Clinical Performance of APTIMA Human Papillomavirus (HPV) 16 18/45 mRNA Genotyping Testing for the Detection of Cervical Intraepithelial Neoplasia 3 (CIN3) or Cancer in a Select Group of Chinese Women.
Qiao et al., Beijing, China. In Pathol Oncol Res, Jan 2016
Totally 394 referred high-risk-HPV-positive women evaluated by Hybrid Capture 2 (HC-2) assay were enrolled.
Sensitivity of APTIMA HPV E6/E7 mRNA test in comparison with hybrid capture 2 HPV DNA test for detection of high risk oncogenic human papillomavirus in 396 biopsy confirmed cervical cancers.
Ratnam et al., Calcutta, India. In J Med Virol, Jan 2016
We determined the sensitivity of AHPV in comparison with the DNA-based Hybrid Capture 2 HPV test (HC2; Qiagen) for the detection of oncogenic HPV in a large number of cervical cancers at the time of diagnosis using cervical samples obtained in ThinPrep (Hologic).
Human Papillomavirus Assays and Cytology in Primary Cervical Screening of Women Aged 30 Years and Above.
Lynge et al., Copenhagen, Denmark. In Plos One, Dec 2015
We compared Hybrid Capture 2 (HC2), cobas, CLART, and APTIMA HPV assays with cytology on 2869 SurePath samples from women undergoing routine screening at 30-65 years in Copenhagen, Denmark.
Triage of ASC-H: A meta-analysis of the accuracy of high-risk HPV testing and other markers to detect cervical precancer.
Arbyn et al., Brussels, Belgium. In Cancer Cytopathol, Dec 2015
RESULTS: The pooled absolute sensitivity and specificity of the Hybrid Capture 2 (HC2) assay for CIN2 + (derived from 19 studies) were 93% (95% confidence interval [CI], 89%-95%) and 45% (95% CI, 41%-50%), respectively.
HPV testing for primary cervical screening: Laboratory issues and evolving requirements for robust quality assurance.
Burroni et al., Florence, Italy. In J Clin Virol, Dec 2015
An HPV test, to be used as primary screening test, must be validated according to international criteria, based on comparison of its clinical accuracy to HC2 or GP5+/6+ PCR-EIA tests.
A review of the clinical performance of the Aptima HPV assay.
Iftner et al., Tübingen, Germany. In J Clin Virol, Dec 2015
One major outcome of this review is the remarkably stable similar sensitivities of AHPV and HC2 independent from study design for detection of CIN2/3+ combined with a higher specificity of the AHPV.
Negative computer-imaged ThinPrep Pap test and positive hybrid capture2 HPV co-testing results: A quality assurance review.
Hoda et al., New York City, United States. In Diagn Cytopathol, Sep 2015
All ThinPrep Pap tests (TPPT) interpreted as negative for intra epithelial lesion (NILM) or NILM with reactive cellular changes (NILM/RCC) and a (+) high-risk HPV [Hybrid Capture 2 (HC2), Qiagen, Hilden, Germany] co-test result over a 45-month period (10/2009-06/2013) underwent monthly QA review.
Comparison of the Roche cobas® 4800 and Digene Hybrid Capture® 2 HPV tests for primary cervical cancer screening in the HPV FOCAL trial.
Krajden et al., Vancouver, Canada. In Bmc Cancer, 2014
We compared the Digene Hybrid Capture® 2 High-Risk HPV DNA Test® (HC2) and the Roche cobas® 4800 HPV Test (COBAS) for primary screening.
The diagnostic value of serum hybrid capture 2 (CH2) HPV DNA in cervical cancer: a systematic review and meta-analysis.
Zhang et al., Shenyang, China. In Tumour Biol, 2014
The diagnostic accuracy of cervical cancer remains a clinical challenge, and a number of studies have used the serum hybrid capture 2 (HC2) human papillomavirus (HPV) DNA in the diagnosis of cervical cancer.
Sperm-specific C-terminal processing of the proteasome PSMA1/α6 subunit.
Sawada et al., Toba, Japan. In Biochem Biophys Res Commun, 2011
LC/MS/MS analysis revealed that the C-terminal 16 residues of sperm alpha6 subunit are processed.
Plasma heparin cofactor II activity is inversely associated with left atrial volume and diastolic dysfunction in humans with cardiovascular risk factors.
Matsumoto et al., Tokushima, Japan. In Hypertens Res, 2011
Plasma heparin cofactor II activity was independently and inversely associated with the development of cardiac remodeling, including cardiac concentric change, left atrial enlargement and left ventricular diastolic dysfunction.
Heparin cofactor II attenuates vascular remodeling in humans and mice.
Aihara, Tokushima, Japan. In Circ J, 2010
[REVIEW]HCII protects against vascular remodeling, including atherosclerosis
Sucrose octasulfate selectively accelerates thrombin inactivation by heparin cofactor II.
Verhamme et al., Nashville, United States. In J Biol Chem, 2010
potential for oversulfated disaccharides in controlling HCII-regulated thrombin generation
Heparin cofactor II in atherosclerotic lesions from the Pathobiological Determinants of Atherosclerosis in Youth (PDAY) study.
Church et al., Chapel Hill, United States. In Exp Mol Pathol, 2009
These results suggest that HCII is in a position to inhibit thrombin in atherosclerotic lesions where thrombin can exert a proatherogenic inflammatory response.
Conformational pathology of the serpins: themes, variations, and therapeutic strategies.
Lomas et al., London, United Kingdom. In Annu Rev Biochem, 2008
Point mutations of antithrombin, C1 inhibitor, alpha(1)-antichymotrypsin, and heparin cofactor II cause a similar conformational transition, resulting in a plasma deficiency that is associated with thrombosis, angioedema, and emphysema.
A new HPV-DNA test for cervical-cancer screening in developing regions: a cross-sectional study of clinical accuracy in rural China.
Lorincz et al., Beijing, China. In Lancet Oncol, 2008
All women were assessed by visual inspection with acetic acid (VIA), Digene High-Risk HPV HC2 DNA Test (HC2), liquid-based cytology, and colposcopy with directed biopsy and endocervical curettage as necessary.
Constitutional heparin co-factor II deficiency associated with recurrent thrombosis.
Boneu et al., In Lancet, 1985
The family of a 36-year-old man with recurrent deep venous thrombosis and heparin co-factor II (HC II) deficiency was investigated for this deficiency.
share on facebooktweetadd +1mail to friends