gopubmed logo
 
find other proteinsAll proteins
GoPubMed Proteins lists recent and important papers and reviews for proteins. Page last changed on 19 Aug 2016.

Fanconi anemia, complementation group F

Fam, FAF, FANCF, USP9X
The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group F. [provided by RefSeq, Jul 2008] (from NCBI)
Top mentioned proteins: CAN, Ubiquitin, HAD, OCT, FANCG
Papers using Fam antibodies
The association of epsin with ubiquitinated cargo along the endocytic pathway is negatively regulated by its interaction with clathrin.
Supplier
Koch Karl-Wilhelm, In PLoS ONE, 2004
... The siRNAs and shRNAs used in this study are as follows: USP9x siRNA1 (target sequence: GACGATGTATTCTCAATCGTA; QIAGEN), USP9x siRNA2 (target sequence: ...
Papers on Fam
The Natural History of the Progression of Atrophy Secondary to Stargardt Disease (ProgStar) Studies: Design and Baseline Characteristics: ProgStar Report No. 1.
New
Progression of Stargardt Disease Study Group et al., London, United Kingdom. In Ophthalmology, Feb 2016
METHODS: In the retrospective study, patients contributed medical record data from at least 2 and up to 4 visits for at least 1 examination modality: fundus autofluorescence (FAF), spectral-domain (SD) optical coherence tomography (SD OCT), and/or microperimetry (MP).
Fundus Autofluorescence and SD-OCT Document Rapid Progression in Autosomal Dominant Vitreoretinochoroidopathy (ADVIRC) Associated with a c.256G > A Mutation in BEST1.
New
Weber et al., Siegburg, Germany. In Ophthalmic Genet, Feb 2016
METHODS: Three affected members of a four-generation ADVIRC family were examined with fundus autofluorescence (FAF), near-infrared autofluorescence (NIA) and spectral domain optical coherence tomography (SD-OCT).
Dystrobrevin recruits Grb2 and α-catulin to organize neurotransmitter receptors at the neuromuscular junction.
New
Proszynski et al., Cambridge, United States. In J Cell Sci, Feb 2016
They include multiple members of the DGC as well as α-catulin, liprin-α1, Usp9x, PI3K, Arhgef5, and Grb2.
USP9X Controls EGFR Fate by Deubiquitinating the Endocytic Adaptor Eps15.
New
Polo et al., Milano, Italy. In Curr Biol, Jan 2016
We focus on USP9X, whose depletion severely affects EGFR turnover, interfering with its internalization and trafficking.
Deubiquitylating enzyme USP9x regulates radiosensitivity in glioblastoma cells by Mcl-1-dependent and -independent mechanisms.
New
Rudner et al., Tübingen, Germany. In Cell Death Dis, Dec 2015
Although ubiquitin ligases facilitate degradation, the deubiquitylating enzyme ubiquitin-specific protease 9x (USP9x) interferes with degradation by removing polyubiquitin chains from Mcl-1, thereby stabilizing this protein.
Hepatotoxicity of green tea: an update.
Review
New
Vitalone et al., Roma, Italy. In Arch Toxicol, Aug 2015
Green tea (GT), obtained from the leaves of Camellia sinensis (L.) Kuntze (Fam.
La FAM fatale: USP9X in development and disease.
Review
New
Wood et al., Brisbane, Australia. In Cell Mol Life Sci, Jun 2015
The ubiquitin-specific protease 9X (USP9X/FAM) is a substrate-specific DUB, which displays an extraordinarily high level of sequence conservation from Drosophila to mammals.
[Inherited retinal or optic nerve disorders – five steps to diagnosis].
Review
New
Stöhr et al., Regensburg, Germany. In Klin Monbl Augenheilkd, Mar 2015
In addition to the basic ophthalmological examination, electrophysiological tests (ERG, n = 2,088, since 1986; EOG, n = 381, since 1986; VEP n = 595, since 1986; mfERG, n = 819, since 1998) and non-invasive retinal imaging (fundus autofluorescence (FAF, n = 1,784, since 2002), near-infrared autofluorescence (NIA, n = 1,091, since 2006), spectral domain OCT (SD-OCT, n = 848, since 2008) and three-wavelengths multicolour spectral reflection imaging (MC, n = 366, since 2013) were performed at least once.
Emerging frontiers in pancreatic cancer research: elaboration of key genes, cells and the extracellular milieu.
Review
Simeone et al., Ann Arbor, United States. In Curr Opin Gastroenterol, 2012
High-throughput sequencing of pancreatic ductal adenocarcinoma as well as neuroendocrine tumors and rarer subtypes of cancers of the pancreas has revealed several novel mutations in genes like PALB2, guanine nucleotide-binding protein, alpha stimulating, death-domain-associated protein, α thalassemia/mental retardation syndrome X linked, switch/sucrose nonfermentable pathway related, and in genes in the ubiquitin-dependent pathways such as USP9X.
Fat facets deubiquitylation of Medea/Smad4 modulates interpretation of a Dpp morphogen gradient.
GeneRIF
Newfeld et al., Tempe, United States. In Development, 2012
Fat facets deubiquitylation of Medea/Smad4 modulates interpretation of a Dpp morphogen gradient
Multimodal fundus imaging in fundus albipunctatus with RDH5 mutation: a newly identified compound heterozygous mutation and review of the literature.
Review
Hwang et al., Taiwan. In Doc Ophthalmol, 2012
Infrared reflectance (IR) imaging showed multiple discrete round lesions, and fundus autofluorescence (FAF) imaging showed decreased autofluorescence.
Ubiquitin-specific peptidase 9, X-linked (USP9X) modulates activity of mammalian target of rapamycin (mTOR).
GeneRIF
Hughes et al., Novato, United States. In J Biol Chem, 2012
the deubiquitinase USP9X as a novel mTORC1 and -2 binding partner that negatively regulates mTOR activity and skeletal muscle differentiation.
The deubiquitinase USP9X suppresses pancreatic ductal adenocarcinoma.
Impact
GeneRIF
Tuveson et al., Cambridge, United Kingdom. In Nature, 2012
loss of Usp9x enhances transformation and protects pancreatic cancer cells from anoikis
Identification of ubiquitin-specific protease 9X (USP9X) as a deubiquitinase acting on ubiquitin-peroxin 5 (PEX5) thioester conjugate.
GeneRIF
Azevedo et al., Porto, Portugal. In J Biol Chem, 2012
Our results suggest that ubiquitin-specific protease 9X (USP9X) is by far the most active deubiquitinase acting on Ub-PEX5, both in female rat liver and HeLa cells.
α-Synuclein fate is determined by USP9X-regulated monoubiquitination.
GeneRIF
Engelender et al., Haifa, Israel. In Proc Natl Acad Sci U S A, 2011
alpha-Synuclein fate is determined by USP9X-regulated monoubiquitination
Ubiquitylation in apoptosis: a post-translational modification at the edge of life and death.
Review
Impact
Wertz et al., San Francisco, United States. In Nat Rev Mol Cell Biol, 2011
For example, ubiquitin E3 ligases, such as MDM2 (which ubiquitylates p53) and inhibitor of apoptosis (IAP) proteins, and deubiquitinases, such as A20 and ubiquitin-specific protease 9X (USP9X) (which regulate the ubiquitylation and degradation of receptor-interacting protein 1 (RIP1) and myeloid leukaemia cell differentiation 1 (MCL1), respectively), have important roles in apoptosis.
DUB-le Trouble for Cell Survival.
Impact
Green et al., Memphis, United States. In Cancer Cell, 2010
A recent paper in Nature identified USP9X as an antagonist of MCL-1 ubiquitinylation and degradation.
Deubiquitinase USP9X stabilizes MCL1 and promotes tumour cell survival.
Impact
GeneRIF
Dixit et al., San Francisco, United States. In Nature, 2010
the deubiquitinase USP9X stabilizes MCL1 and thereby promotes cell survival; deubiquitinases may stabilize labile oncoproteins in human malignancies
FAM/USP9x, a deubiquitinating enzyme essential for TGFbeta signaling, controls Smad4 monoubiquitination.
Impact
GeneRIF
Piccolo et al., Padova, Italy. In Cell, 2009
Smad4 is monoubiquitinated in lysine 519 in vivo, a modification that inhibits Smad4 by impeding association with phospho-Smad2; FAM reverts this negative modification, re-empowering Smad4 function.
share on facebooktweetadd +1mail to friends