gopubmed logo
 
find other proteinsAll proteins
GoPubMed Proteins lists recent and important papers and reviews for proteins. Page last changed on 08 Dec 2016.

Caveolin 1, caveolae protein, 22kDa

caveolin-1, caveolin, Cav-1
The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010] (from NCBI)
Top mentioned proteins: V1a, CAN, HAD, Akt, caveolin-3
Papers using caveolin-1 antibodies
S1P lyase: a novel therapeutic target for ischemia-reperfusion injury of the heart
Supplier
Bruni Paola et al., In Skeletal Muscle, 2010
... Monoclonal anti-caveolin-3 antibodies were from BD Biosciences Transduction Laboratories (Lexington, KY, ...
Persistent eNOS activation secondary to caveolin-1 deficiency induces pulmonary hypertension in mice and humans through PKG nitration
Supplier
Malik Asrar B. et al., In The Journal of Cell Biology, 2008
... Covance), anti-phosphotyrosine (PY20), and PECAM-1 (BD); anti–VE-cadherin, anti–β-actin, anti-β, and anti-p120 catenins; anti-RhoA, anti-eNOS, and anti–Cav-1 (Santa Cruz Biotechnology, Inc.); anti-p190RhoGAP (Sigma-Aldrich); anti-nitrotyrosine, ...
Extracellular superoxide dismutase is a growth regulatory mediator of tissue injury recovery.
Supplier
Stadler Krisztian, In PLoS ONE, 2008
... Anti-caveolin-1 antibody was from BD Biosciences.
Neuronal AKAP150 coordinates PKA and Epac mediated PKB/Akt phosphorylation
Supplier
Schmidt Martina et al., In Respiratory Research, 2007
... The antibodies against Rap1 (121, sc-65), Rap2 (124, sc-164) and caveolin-1 (N-20, sc-894) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), and ...
Effect of intraocular surgery and ketamine on aqueous and serum cytokines.
Supplier
Jin Chongfei et al., In Molecular Vision, 2006
... Anti-caveolin-1 polyclonal antibody was purchased from BD Biosciences Transduction Laboratories (San Diego, ...
more suppliers
Papers on caveolin-1
Reconstitution and spectroscopic analysis of caveolin-1 residues 62-178 reveals that proline 110 governs its structure and solvent exposure.
New
Glover et al., Bethlehem, United States. In Biochim Biophys Acta, Feb 2016
UNASSIGNED: Caveolin-1 is a membrane protein that possesses an unusual topology where both N- and C- termini are cytoplasmic as a result of a membrane-embedded turn.
p53- and PAI-1-mediated induction of C-X-C chemokines and CXCR2: Importance in Pulmonary Inflammation due to Cigarette Smoke exposure.
New
Shetty et al., Tyler, United States. In Am J Physiol Lung Cell Mol Physiol, Feb 2016
Further, inhibition of p53-mediated induction of PAI-1 expression by treatment of WT mice exposed to passive CS with caveolin-1 scaffolding domain peptide (CSP) reduced CXCL1, CXCL2 and CXCR2 levels and lung inflammation.
Genomic variant in CAV1 increases susceptibility to coronary artery disease and myocardial infarction.
New
Wang et al., Wuhan, China. In Atherosclerosis, Feb 2016
BACKGROUND: The CAV1 gene encodes caveolin-1 expressed in cell types relevant to atherosclerosis.
Vascular and autonomic dysregulation in primary open-angle glaucoma.
Review
New
Pasquale, Boston, United States. In Curr Opin Ophthalmol, Jan 2016
Interestingly, common genetic variation in nitric oxide synthase 3 (NOS3) and the caveolin 1/caveolin 2 (CAV1/CAV2) genomic regions, which code for proteins involved in setting vascular tone, are associated with POAG.
Beyond Ussing's chambers: Contemporary thoughts on integration of transepithelial transport.
Review
New
Turner et al., Chicago, United States. In Am J Physiol Cell Physiol, Jan 2016
They found that TNF induces barrier dysfunction via MLCK activation and downstream caveolin-1-dependent endocytosis of the tight junction protein occludin.
Mutant p53 determines pancreatic cancer poor prognosis to pancreatectomy through upregulation of cavin-1 in patients with preoperative serum CA19-9 ≥ 1,000 U/mL.
New
Yu et al., Shanghai, China. In Sci Rep, Dec 2015
Here, we elucidated the relationship between this signature and driver-gene mutations, and the cavins/caveolin-1 axis.
Molecular Determinants of the Cellular Entry of Asymmetric Peptide Dendrimers and Role of Caveolae.
New
Parat et al., Australia. In Plos One, Dec 2015
Cell-based studies were performed using wild type or caveola-deficient i.e. caveolin-1 or PTRF gene-disrupted cells.
ADVANCED IMAGING. Extended-resolution structured illumination imaging of endocytic and cytoskeletal dynamics.
New
Impact
Betzig et al., United States. In Science, Sep 2015
We applied these approaches to image dynamics near the plasma membrane of spatially resolved assemblies of clathrin and caveolin, Rab5a in early endosomes, and α-actinin, often in relationship to cortical actin.
Estrogen receptors in the central nervous system and their implication for dopamine-dependent cognition in females.
Review
New
Brake et al., Montréal, Canada. In Horm Behav, Aug 2015
The mechanism through which ERs are associated with the membrane remains unclear, but palmitoylation of receptors and associations between ERs and caveolin are implicated in membrane association.
Building endocytic pits without clathrin.
New
Impact
Mayor et al., Paris, France. In Nat Rev Mol Cell Biol, May 2015
How endocytic pits are built in clathrin- and caveolin-independent endocytosis still remains poorly understood.
Lesser-Known Molecules in Ovarian Carcinogenesis.
Review
Căruntu et al., Jászvásár, Romania. In Biomed Res Int, 2014
Within this framework, this review presents three protein molecules: ALCAM, c-FLIP, and caveolin, motivated by the perspectives provided through the current limited knowledge on their role in ovarian carcinogenesis and on their potential as prognosis factors.
Calcium-Sensing Receptor: Trafficking, Endocytosis, Recycling, and Importance of Interacting Proteins.
Review
Ray, Bethesda, United States. In Prog Mol Biol Transl Sci, 2014
These processes are impacted by its interactions with several proteins in addition to signaling molecules per se (i.e., G-proteins, protein kinases, inositol phosphates, etc.) and include small molecular weight G-proteins (Sar1, Rabs, ARF, P24A, RAMPs, filamin A, 14-3-3 proteins, calmodulin, and caveolin-1).
In vivo proteomic imaging analysis of caveolae reveals pumping system to penetrate solid tumors.
Impact
Schnitzer et al., San Diego, United States. In Nat Med, 2014
This transvascular pumping required the expression of caveolin 1 and annexin A1.
PDK1 decreases TACE-mediated α-secretase activity and promotes disease progression in prion and Alzheimer's diseases.
Impact
Schneider et al., Paris, France. In Nat Med, 2013
PDK1 induces phosphorylation and caveolin-1-mediated internalization of TACE.
Caveolin-1 suppresses human immunodeficiency virus-1 replication by inhibiting acetylation of NF-κB.
GeneRIF
Hildreth et al., Nashville, United States. In Virology, 2012
Since hypoacetylated p65 has been shown to inhibit transcription, the authors conclude that caveolin-1 inhibits HIV-1 transcription through a NF-kappaB-dependent mechanism.
Functional interaction of tumor suppressor DLC1 and caveolin-1 in cancer cells.
GeneRIF
Lowy et al., Bethesda, United States. In Cancer Res, 2012
complex formation between the DLC1 START domain and CAV-1 contributes to DLC1 tumor suppression via a RhoGAP-independent mechanism, and suggest that DLC1 inactivation probably contributes to cancer progression.
Caveolin-1 plays a critical role in the differentiation of monocytes into macrophages.
GeneRIF
Chin-Dusting et al., Melbourne, Australia. In Arterioscler Thromb Vasc Biol, 2012
Caveolin-1 promotes monocyte to macrophage differentiation through the regulation of EGR-1 transcriptional activity, suggesting that phagocytic caveolin-1 may be critical for atherogenesis.
Leptin signaling in adipose tissue: role in lipid accumulation and weight gain.
GeneRIF
Somers et al., Rochester, United States. In Circ Res, 2012
In healthy humans, increases in leptin, as seen with modest weight gain, may increase caveolin-1 expression in adipose tissue; increased caveolin-1 expression in turn impairs leptin signaling.
Constitutive formation of caveolae in a bacterium.
Impact
Parton et al., Brisbane, Australia. In Cell, 2012
Caveolin plays an essential role in the formation of characteristic surface pits, caveolae, which cover the surface of many animal cells.
Caveolin-1 plays a critical role in host immunity against Klebsiella pneumoniae by regulating STAT5 and Akt activity.
GeneRIF
Wu et al., Grand Forks, United States. In Eur J Immunol, 2012
Cav1 may offer resistance to Klebsiella pneumoniae infection, by affecting both systemic and local production of proinflammatory cytokines via the actions of STAT5 and the GSK3beta-beta-catenin-Akt pathway.
More papers using caveolin-1 antibodies
The Csk-binding protein PAG regulates PDGF-induced Src mitogenic signaling via GM1
Supplier
Benistant Christine et al., In The Journal of Cell Biology, 2005
... siRNAs specific for mouse Caveolin-1 (AAGCAAGTGTATGACGCGCAC), mouse Neu-3 (AAGGATTAACCTAGGCATCTA), and corresponding scramble siRNAs were obtained from QIAGEN.
Divergent responses of chondrocytes and endothelial cells to shear stress: cross-talk among COX-2, the phase 2 response, and apoptosis.
Supplier
Zheng Song Guo, In PLoS ONE, 2004
... was from Sigma-Aldrich Corp and monoclonal antibody specific for IL-6 as well as TLR4 and caveolin-1 siRNAs were from Santa Cruz Biotechnology, Inc (Santa Cruz, CA) ...
Binding of Par-4 to the actin cytoskeleton is essential for Par-4/Dlk-mediated apoptosis.
Supplier
Harwood Adrian John, In PLoS ONE, 2004
... The following primary antibodies were used: rabbit polyclonal anti-caveolin-1 (Cell Signaling, Danvers, MA), mouse monoclonal ...
Clathrin- and caveolin-1–independent endocytosis
Supplier
Helenius Ari et al., In The Journal of Cell Biology, 2003
... Antibodies were obtained from the following sources: rabbit anti–cav-1(N20) (Santa Cruz Biotechnology, Inc.), mouse anti–cav-2 and ...
Caveolin-1 expression is critical for vascular endothelial growth factor-induced ischemic hindlimb collateralization and nitric oxide-mediated angiogenesis
Supplier
Vermes I. et al., In International Journal of Cell Biology, 2003
... Caveolin-1 siRNA was bought from Qiagen (West Sussex, Ireland) (cat ...
Mitogen-activated protein kinase pathways defend against bacterial pore-forming toxins 1.
Supplier
Linden Rafael, In PLoS ONE, 2003
... Cav-1(pY14) mouse monoclonal antibody, Anti-PARP(cleaved) antibody were procured from BD Biosciences.
Small GTPase Rab21 regulates cell adhesion and controls endosomal traffic of β1-integrins
Supplier
Ivaska Johanna et al., In The Journal of Cell Biology, 2003
... Antibodies against the following antigens were used: EEA1, Rab5A, Rab7, Rab11, caveolin-1 (all from Santa Cruz Biotechnology, Inc.), Rab21 ( ...
Interactions of LY333531 and other bisindolyl maleimide inhibitors with PDK1
Supplier
Haslam Niall James, In PLoS ONE, 2003
... Shared motifs between caveolin-interacting proteins were sought with the SLiMFinder webserver (with or without disorder masking) using UniProt IDs as the input ...
Modulation of phospholipase D-mediated phosphatidylglycerol formation by differentiating agents in primary mouse epidermal keratinocytes
Supplier
Mahoney Mỹ G. et al., In Oncogene, 2002
... Commercially purchased primary antibodies were: Cav-1 (1:200 immunofluorescence (IF), 1:1000 immunoblotting (IB)) and H-145 (1:1000 IB) from Santa Cruz Biotechnology (Santa Cruz, CA, USA); ...
Isoform-specific insulin receptor signaling involves different plasma membrane domains
Supplier
Leibiger Ingo B. et al., In The Journal of Cell Biology, 2001
... the following primer combinations were used: caveolin-1α (5′-AACCTCCTCAGAGCCTG-3′ and 5′-CTGCGAGAGCAACTTGG-3′), caveolin-1β (5′-GCCAGGCTGACTCTTGA-3′ and 5′-CTGCGAGAGCAACTTGG-3′), and caveolin-2 (5′-AGCCACTCTTGCAACGCCAG-3′ and 5′-TGAGTGGTCAGTCGTGGCTC-3′).RNA was isolated from 50 islets using the RNeasy kit (QIAGEN).
A new mathematical model for relative quantification in real-time RT-PCR.
Supplier
Gimble Jeffrey M., In PLoS ONE, 2000
... Anti TSHR, anti-caveolin 1, horseradish peroxidase (HRP)-conjugated secondary antibody, fluorescein isothiocyanate (FITC)-conjugated secondary antibody were obtained from Santa Cruz Biotechnology, Inc ...
Vascular endothelial cadherin controls VEGFR-2 internalization and signaling from intracellular compartments
Supplier
Dejana Elisabetta et al., In The Journal of Cell Biology, 2000
... Antibody to EEA-1 was goat polyclonal N-19 (sc-6415; Santa Cruz Biotechnology, Inc.); antibody to caveolin-1 was rabbit polyclonal N-20 (sc-894; Santa Cruz Biotechnology, Inc.); and antibody to ...
Role of the molten globule state in protein folding
Supplier
Ball Judith M et al., In Virology Journal, 1999
... )-ATPase α (Affinity BioReagents, Inc., Golden, CO), rabbit anti-cav-1 (Cell Signaling, Danvers, MA), goat anti-rabbit ...
Obesity-related overexpression of fatty-acid synthase gene in adipose tissue involves sterol regulatory element-binding protein transcription factors
Supplier
Hajduch Eric et al., In Diabetes, 1997
... Antibodies against caveolin-1 were purchased from BD Biosciences; native PKB/Akt, Ser473-PKB, Thr308-PKB, ...
The O-glycosylated stalk domain is required for apical sorting of neurotrophin receptors in polarized MDCK cells
Supplier
Simons Kai et al., In The Journal of Cell Biology, 1996
... Polyclonal anti-caveolin 1 antibody was purchased from Santa Cruz Biotechnology, Inc. ...
VIP21/caveolin, glycosphingolipid clusters and the sorting of glycosylphosphatidylinositol-anchored proteins in epithelial cells
Supplier
Ikonen E. et al., In The Journal of Cell Biology, 1993
... ) and the anti–caveolin-1 antibody designated N-20 was from Santa Cruz Biotechnology, Inc. ...
Endothelial fenestrae in the rat fetal cerebrum
Supplier
Risau Werner et al., In The Journal of Cell Biology, 1987
... Anti–caveolin-1 antibodies were described previously (Dupree et al., 1993) or were purchased from Santa Cruz Biotechnology, Inc. ...
The fine structure of the gall bladder epithelium of the mouse
Supplier
Endo Yasuhisa et al., In Acta Histochemica et Cytochemica, 1954
... Mouse monoclonal anti-caveolin-1 antibody was from Research Diagnostics (Flanders, NJ) ...
share on facebooktweetadd +1mail to friends